Review

nf κb dna binding activity (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher nf κb dna binding activity
Nf κb Dna Binding Activity, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+%CE%BAb+dna+binding+activity/DNA/pmc12696327-58-7-24
Average 99 stars, based on 1 article reviews

nf κb dna binding activity - by Bioz Stars, 2026-10

99/100 stars

Images

Activity Assay:

Article Title: POCU1b, the n-Butanol Soluble Fraction of Polygoni Cuspidati Rhizoma et Radix, Attenuates Obesity, Non-Alcoholic Fatty Liver, and Insulin Resistance via Inhibitions of Pancreatic Lipase, cAMP-Dependent PDE Activity, AMPK Activation, and SOCS-3 Suppression
Article Snippet: Nuclear proteins were isolated using commercially available nuclear and cytoplasmic extraction kits (Pierce, Rockford, IL, USA). .. NF-κB DNA-binding activity was evaluated using an ELISA-based EZ-Detect TM Transcription Factor Kit for NF-κB p65 (Thermo Fisher Scientific InC., Rockford, IL, USA) according to the manufacturer’s instructions. ..

Article Title: Effects of orlistat combined with enzalutamide and castration through inhibition of fatty acid synthase in a PC3 tumor-bearing mouse model
Article Snippet: The following DNA sequences were synthesized for assessing NF-κB activity using EMSA: sense, AGTTGAGGGGACTTTCCCAGGC (oligo ID, 1914063653; Protech Technology, Taipei, Taiwan) and antisense, GCCTGGGAAAGTCCCCTCAAC (oligo ID, 1914063652; Protech Technology, Taipei, Taiwan). .. NF-κB /DNA binding activity was measured using the LightShift Chemiluminescent EMSA kit (cat. no. 20148; Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions. ..

Article Title: Fatty Acid Inhibition Sensitizes Androgen-Dependent and -Independent Prostate Cancer to Radiotherapy via FASN/NF-κB Pathway
Article Snippet: Nuclear proteins were isolated from LNCaP and PC3 cells using Nuclear Extraction kit (Chemicon International) according to the manufacturer’s protocol. .. The NF-κB/DNA binding activity was evaluated using the LightShift Chemiluminescent EMSA kit (Pierce). ..

Article Title: Quetiapine ameliorates collagen-induced arthritis in mice via the suppression of the AKT and ERK signaling pathways.
Article Snippet: Objective and design To investigate the amelioration effects of quetiapine on rheumatoid arthritis with RAW 264.7 macrophage and collagen-induced arthritis (CIA) DBA/1J mouse model.. Subjects RAW 264.7 macrophage and DBA/1J mice.. Treatment Lipopolysaccharide and collagen.

Article Title: DHA alleviated hepatic and adipose inflammation with increased adipocyte browning in high-fat diet-induced obese mice.
Article Snippet: Obesity is associated with accumulation of inflammatory immune cells in white adipose tissue, whereas thermogenic browning adipose tissue is inhibited.. Dietary fatty acids are important nutritional components and several clinical and experimental studies have reported beneficial effects of docosahexaenoic acid (DHA) on obesity-related metabolic changes.. In this study, we investigated effects of DHA on hepatic and adipose inflammation and adipocyte browning in high-fat diet-induced obese C57BL/6J mice, and in vitro 3T3-L1 preadipocyte differentiation.

Article Title: Asiatic acid inhibits NF-κB signaling and ameliorates experimental acute and chronic colitis in mice
Article Snippet: .. To assess the effect of AA on NF-κB DNA-binding activity, electrophoretic mobility shift assays (EMSA) were conducted using the LightShift ® Chemiluminescent EMSA Kit (Thermo Scientific, Rockford, IL, USA)., COLO 205 cells were either left untreated or exposed to AA at low (10 μM) or high (30 μM) concentrations for 24 h, followed by stimulation with 10 ng/mL TNF-α for 30 min. Nuclear extracts were prepared and incubated with a biotin-conjugated DNA oligonucleotide probe (labeled at the 3′ end) complementary to the NF-κB consensus sequence to assess binding activity. .. To confirm the specificity of DNA-protein interactions, a supershift assay was performed using anti-NF-κB p50 antibodies (Santa Cruz Biotechnology, Dallas, TX, USA).

Article Title: Synergistic Effect of Ginsenoside Rh2 Combines with Ionizing Radiation on CT26/ luc Colon Carcinoma Cells and Tumor-Bearing Animal Model.
Article Snippet: .. The NF-κB/DNA binding activity was evaluated using the LightShift Chemiluminescent EMSA kit (cat. no. 20148, Thermo Fisher Scientific, Waltham, MA, USA). ..

Enzyme-linked Immunosorbent Assay:

Binding Assay:

Electrophoretic Mobility Shift Assay:

Incubation:

Labeling:

Sequencing:

Image Search Results

Figure 2. Resveratrol treatment suppressed the chronic unpredictable mild stress-induced changes of the protein levels of Sirt1, NF-κB p65, ac-p65, and Iκ-Bα in the mouse hippocampus via Western blot. *P < 0.05 vs. the control group; &P < 0.05 vs. the depression model group.

Journal: Future science OA

Article Title: Resveratrol alleviates depressive-like behavior via the activation of SIRT1/NF-κB signaling pathway in microglia.

doi: 10.1080/20565623.2025.2463852

Figure Lengend Snippet: Figure 2. Resveratrol treatment suppressed the chronic unpredictable mild stress-induced changes of the protein levels of Sirt1, NF-κB p65, ac-p65, and Iκ-Bα in the mouse hippocampus via Western blot. *P < 0.05 vs. the control group; &P < 0.05 vs. the depression model group.

Article Snippet: NF-κB p65 DNA binding activity assay nF-κB p65 dna binding activity was detected using transam nF-κB p65 Chemi tran-scription Factor assay Kit (active motif, Carlsbad, Ca) according to the instructions of manufacturer.

Techniques: Western Blot, Control

Figure 3. Resveratrol treatment suppressed the chronic unpredictable mild stress-induced changes of the protein levels of Sirt1, NF-κB p65, ac-p65, and Iκ-Bα in the mouse prefrontal cortex via Western blot. *P < 0.05 vs. the control group; &P < 0.05 vs. the depression model group.

Journal: Future science OA

Article Title: Resveratrol alleviates depressive-like behavior via the activation of SIRT1/NF-κB signaling pathway in microglia.

doi: 10.1080/20565623.2025.2463852

Figure Lengend Snippet: Figure 3. Resveratrol treatment suppressed the chronic unpredictable mild stress-induced changes of the protein levels of Sirt1, NF-κB p65, ac-p65, and Iκ-Bα in the mouse prefrontal cortex via Western blot. *P < 0.05 vs. the control group; &P < 0.05 vs. the depression model group.

Techniques: Western Blot, Control

Figure 5. Resveratrol treatment suppressed the LPS-induced changes of the protein levels of Sirt1, NF-κB p65, ac-p65, and Iκ-Bα in BV2 cells via Western blot. *P < 0.05 vs. the control group; **P < 0.01 vs. the control group; ***P < 0.001 vs. the control group.

Journal: Future science OA

Article Title: Resveratrol alleviates depressive-like behavior via the activation of SIRT1/NF-κB signaling pathway in microglia.

doi: 10.1080/20565623.2025.2463852

Figure Lengend Snippet: Figure 5. Resveratrol treatment suppressed the LPS-induced changes of the protein levels of Sirt1, NF-κB p65, ac-p65, and Iκ-Bα in BV2 cells via Western blot. *P < 0.05 vs. the control group; **P < 0.01 vs. the control group; ***P < 0.001 vs. the control group.

Techniques: Western Blot, Control

SPFPT@siImp7/PD-LNP inhibits the release of proinflammatory cytokines. AECs were incubated with saline, SPFPT@PD-LNP, SPFPT@siImp7/PD-LNP, and SPFPT@siImp7-LNP for 1 h, and then subjected to cyclic stretch. Static cells served as control. ( A) Representative images of p-p38 expression in AECs under the microscope (Scale bar, 5 μm). Immunostaining was performed with p-p38 (red) and counterstained with DAPI to detect nuclei (blue). (B) Quantification of the nucleo-cytoplasmic distribution of p-p38. (C) Relative NF-κB activity in CS-stimulated AECs incubated with saline, SPFPT@PD-LNP, SPFPT@siImp7/PD-LNP, and SPFPT@siImp7-LNP. (D) Western blotting analysis of p-p38, p38, p-ATF2, p-MK2, p-IκBα, IκBα, p-P65, P65, and GAPDH in AECs. (E) Relative expression of p-p38, p-ATF2, p-MK2, p-IκBα, and p-P65 in AECs measured by Western blotting. (F) AECs were incubated with saline, SPFPT@PD-LNP, SPFPT@siImp7/PD-LNP, SPFPT@siImp7-LNP, and budesonide for 1 h, and then subjected to cyclic stretch. Static cells served as control. The mRNA levels of TNF-α, IL-6, and HMGB1 in AECs were evaluated using qRT-PCR. (G) AECs were incubated with saline, SPFPT@PD-LNP, SPFPT@siImp7/PD-LNP, SPFPT@siImp7-LNP, and budesonide for 1 h, and then subjected to cyclic stretch. Static cells served as control. The protein levels of TNF-α, IL-6, and HMGB1 in the culture supernatant of AECs were evaluated using ELISA. (H) Mice were randomized to the sham-operated group and the VILI group. In the VILI group, mice were intratracheally administered with saline, SPFPT@PD-LNP, SPFPT@siImp7/PD-LNP, SPFPT@siImp7-LNP, and budesonide, respectively. The protein levels of TNF-α, IL-6, and HMGB1 in BALF of mice were evaluated using ELISA. Data are expressed as mean ± SEM from 6 mice per group. Significance: * p < 0.05, ** p < 0.01, ***p < 0.001, ns: no significance.

Journal: Theranostics

Article Title: Precision treatment of ventilator-induced lung injury through alveolar epithelial cell targeted lipid nanoparticle delivery

doi: 10.7150/thno.111200

Figure Lengend Snippet: SPFPT@siImp7/PD-LNP inhibits the release of proinflammatory cytokines. AECs were incubated with saline, SPFPT@PD-LNP, SPFPT@siImp7/PD-LNP, and SPFPT@siImp7-LNP for 1 h, and then subjected to cyclic stretch. Static cells served as control. ( A) Representative images of p-p38 expression in AECs under the microscope (Scale bar, 5 μm). Immunostaining was performed with p-p38 (red) and counterstained with DAPI to detect nuclei (blue). (B) Quantification of the nucleo-cytoplasmic distribution of p-p38. (C) Relative NF-κB activity in CS-stimulated AECs incubated with saline, SPFPT@PD-LNP, SPFPT@siImp7/PD-LNP, and SPFPT@siImp7-LNP. (D) Western blotting analysis of p-p38, p38, p-ATF2, p-MK2, p-IκBα, IκBα, p-P65, P65, and GAPDH in AECs. (E) Relative expression of p-p38, p-ATF2, p-MK2, p-IκBα, and p-P65 in AECs measured by Western blotting. (F) AECs were incubated with saline, SPFPT@PD-LNP, SPFPT@siImp7/PD-LNP, SPFPT@siImp7-LNP, and budesonide for 1 h, and then subjected to cyclic stretch. Static cells served as control. The mRNA levels of TNF-α, IL-6, and HMGB1 in AECs were evaluated using qRT-PCR. (G) AECs were incubated with saline, SPFPT@PD-LNP, SPFPT@siImp7/PD-LNP, SPFPT@siImp7-LNP, and budesonide for 1 h, and then subjected to cyclic stretch. Static cells served as control. The protein levels of TNF-α, IL-6, and HMGB1 in the culture supernatant of AECs were evaluated using ELISA. (H) Mice were randomized to the sham-operated group and the VILI group. In the VILI group, mice were intratracheally administered with saline, SPFPT@PD-LNP, SPFPT@siImp7/PD-LNP, SPFPT@siImp7-LNP, and budesonide, respectively. The protein levels of TNF-α, IL-6, and HMGB1 in BALF of mice were evaluated using ELISA. Data are expressed as mean ± SEM from 6 mice per group. Significance: * p < 0.05, ** p < 0.01, ***p < 0.001, ns: no significance.

Article Snippet: The nuclear fraction of cell lysates was obtained using a nuclear protein extraction reagent (Thermo Fisher, Rockford, IL), and the NF-κB (p65) DNA-binding activity in a sample containing 5.0 mg of total protein was determined using the NF-κB (p65) DNA-binding TransAM ELISA kit (Thermo Fisher, Rockford, IL).

Techniques: Incubation, Saline, Control, Expressing, Microscopy, Immunostaining, Activity Assay, Western Blot, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

Fig. 6. Molecular docking of Nicotiflorin with TLR4, p65, Caspase-1, NLRP3, and IL-1β. (A) Schematic diagram of molecular docking of Nicotiflorin with TLR4. (B) Schematic diagram of molecular docking of Nicotiflorin with p65. (C) Schematic diagram of molecular docking of Nicotiflorin with Caspase-1. (D) Schematic diagram of molecular docking of Nicotiflorin with NLRP3. (E) Schematic diagram of molecular docking of Nicotiflorin with IL-1β.

Journal: Phytomedicine : international journal of phytotherapy and phytopharmacology

Article Title: Mechanism of Nicotiflorin in San-Ye-Qing rhizome for anti-inflammatory effect in ulcerative colitis.

doi: 10.1016/j.phymed.2024.155564

Figure Lengend Snippet: Fig. 6. Molecular docking of Nicotiflorin with TLR4, p65, Caspase-1, NLRP3, and IL-1β. (A) Schematic diagram of molecular docking of Nicotiflorin with TLR4. (B) Schematic diagram of molecular docking of Nicotiflorin with p65. (C) Schematic diagram of molecular docking of Nicotiflorin with Caspase-1. (D) Schematic diagram of molecular docking of Nicotiflorin with NLRP3. (E) Schematic diagram of molecular docking of Nicotiflorin with IL-1β.

Article Snippet: NF-κB p65 DNA binding activity was measured with the TransAM NF-κB p65 Activation Assay kit (40096, Active Motif, USA) following the manufacturer’s protocol.

Techniques:

Fig. 7. p65 is a Key Target of Nicotiflorin. (A) Flowchart of the CETSA assay. (B) WB validation results of CETSA assay samples. The p65 protein treated with nicotiflorin had better thermal stability. (C) Analysis of relative grey values of WB validation results of CETSA assay samples. (D) Flowchart of the DARTS assay.(E) WB validation results of DARTS assay samples. The p65 protein treated with Nicotiflorin was more tolerant to pronase. (F-G) Biacore analysis results of Nicotiflorin and p65. The dots represents various concentrations of Nicotiflorin. Nicotiflorin binds to p65 with a KD of 47.39 nM. (H) The enzyme activity of p65. The activity of p65 protein in the protein treated with Nicotiflorin decreased significantly.

Journal: Phytomedicine : international journal of phytotherapy and phytopharmacology

Article Title: Mechanism of Nicotiflorin in San-Ye-Qing rhizome for anti-inflammatory effect in ulcerative colitis.

doi: 10.1016/j.phymed.2024.155564

Figure Lengend Snippet: Fig. 7. p65 is a Key Target of Nicotiflorin. (A) Flowchart of the CETSA assay. (B) WB validation results of CETSA assay samples. The p65 protein treated with nicotiflorin had better thermal stability. (C) Analysis of relative grey values of WB validation results of CETSA assay samples. (D) Flowchart of the DARTS assay.(E) WB validation results of DARTS assay samples. The p65 protein treated with Nicotiflorin was more tolerant to pronase. (F-G) Biacore analysis results of Nicotiflorin and p65. The dots represents various concentrations of Nicotiflorin. Nicotiflorin binds to p65 with a KD of 47.39 nM. (H) The enzyme activity of p65. The activity of p65 protein in the protein treated with Nicotiflorin decreased significantly.

Article Snippet: NF-κB p65 DNA binding activity was measured with the TransAM NF-κB p65 Activation Assay kit (40096, Active Motif, USA) following the manufacturer’s protocol.

Techniques: Biomarker Discovery, Activity Assay

Fig. 8. Nicotiflorin suppresses inflammation in vitro by inhibiting NF-κB activation and NLRP3 inflammasome activation. (A) Expression of p-p65, p65, p- IκBα, and IκBα of NF-κB signaling pathway species in cells after addition of Nicotiflorin to BMDMs. (B-D) Concentrations of IL-1β, IL-6, and IL-18 in cell supernatants after addition of Nicotiflorin to BMDMs. (E) Expression of Caspase-1, IL-1β, and NLRP3 in cells and expression of Caspase-1 p20, IL-1β p17 in cell supernatants after addition of Nicotiflorin to BMDMs (ns p ≥0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).

Journal: Phytomedicine : international journal of phytotherapy and phytopharmacology

Article Title: Mechanism of Nicotiflorin in San-Ye-Qing rhizome for anti-inflammatory effect in ulcerative colitis.

doi: 10.1016/j.phymed.2024.155564

Figure Lengend Snippet: Fig. 8. Nicotiflorin suppresses inflammation in vitro by inhibiting NF-κB activation and NLRP3 inflammasome activation. (A) Expression of p-p65, p65, p- IκBα, and IκBα of NF-κB signaling pathway species in cells after addition of Nicotiflorin to BMDMs. (B-D) Concentrations of IL-1β, IL-6, and IL-18 in cell supernatants after addition of Nicotiflorin to BMDMs. (E) Expression of Caspase-1, IL-1β, and NLRP3 in cells and expression of Caspase-1 p20, IL-1β p17 in cell supernatants after addition of Nicotiflorin to BMDMs (ns p ≥0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).

Article Snippet: NF-κB p65 DNA binding activity was measured with the TransAM NF-κB p65 Activation Assay kit (40096, Active Motif, USA) following the manufacturer’s protocol.

Techniques: In Vitro, Activation Assay, Expressing

NF-κB signaling pathway. The transcription factor NF-κB is constitutively expressed in the central nervous system (CNS), where it can be activated by several stimuli, including TNFα, opioids, β-amyloid, and sAPP, to name a few. The NF-κB complex is sequestered in a dimer form (with p65/p50 dimers as the most common composition) in the cytoplasm, where it is bound by IκB. Upon activation by various stimuli, IKK interacts with the inhibitory IκB, resulting in phosphorylation, ubiquitination, and degradation of IκB, rendering the dimer free to translocate to the nucleus. Here, the dimer binds to kappa B binding sites of several gene targets that may be involved in cell survival in neurons or inflammatory pathways in glia. Dimers consisting of p65/p50 tend to be transcriptionally active, whereas p50 homodimers tend to suppress gene transcription. Red text indicates methods appropriate to investigate specific components of NF-κB signaling. BDNF = brain-derived neurotrophic factor; CaMKII = calcium-calmodulin kinase II; ChIP = chromatin immunoprecipitation; ELISA = enzyme-linked immunosorbent assay; EMSA = gel electrophoresis mobility shift assay; IκB = inhibitory κB protein; IKK = inhibitory κB protein kinase; MnSOD = manganese superoxide dismutase; PCR = polymerase chain reaction; PSD-95 = postsynaptic density protein-95; sAPP = secreted amyloid precursor protein; TNFα = tumor necrosis factor alpha.

Journal: Cells

Article Title: Challenges with Methods for Detecting and Studying the Transcription Factor Nuclear Factor Kappa B (NF-κB) in the Central Nervous System

doi: 10.3390/cells10061335

Figure Lengend Snippet: NF-κB signaling pathway. The transcription factor NF-κB is constitutively expressed in the central nervous system (CNS), where it can be activated by several stimuli, including TNFα, opioids, β-amyloid, and sAPP, to name a few. The NF-κB complex is sequestered in a dimer form (with p65/p50 dimers as the most common composition) in the cytoplasm, where it is bound by IκB. Upon activation by various stimuli, IKK interacts with the inhibitory IκB, resulting in phosphorylation, ubiquitination, and degradation of IκB, rendering the dimer free to translocate to the nucleus. Here, the dimer binds to kappa B binding sites of several gene targets that may be involved in cell survival in neurons or inflammatory pathways in glia. Dimers consisting of p65/p50 tend to be transcriptionally active, whereas p50 homodimers tend to suppress gene transcription. Red text indicates methods appropriate to investigate specific components of NF-κB signaling. BDNF = brain-derived neurotrophic factor; CaMKII = calcium-calmodulin kinase II; ChIP = chromatin immunoprecipitation; ELISA = enzyme-linked immunosorbent assay; EMSA = gel electrophoresis mobility shift assay; IκB = inhibitory κB protein; IKK = inhibitory κB protein kinase; MnSOD = manganese superoxide dismutase; PCR = polymerase chain reaction; PSD-95 = postsynaptic density protein-95; sAPP = secreted amyloid precursor protein; TNFα = tumor necrosis factor alpha.

Article Snippet: On the other hand, EMSA [ ] and commercial DNA binding ELISA (such as TransAM ® NF-κB activation assays from Active Motif ® ) have been widely used to assay NF-κB activation [ , , , ].

Techniques: Activation Assay, Phospho-proteomics, Ubiquitin Proteomics, Binding Assay, Derivative Assay, Chromatin Immunoprecipitation, Enzyme-linked Immunosorbent Assay, Nucleic Acid Electrophoresis, Mobility Shift, Polymerase Chain Reaction

Summary of the advantages and disadvantages of the methods used for NF-κB detection.

Journal: Cells

Article Title: Challenges with Methods for Detecting and Studying the Transcription Factor Nuclear Factor Kappa B (NF-κB) in the Central Nervous System

doi: 10.3390/cells10061335

Figure Lengend Snippet: Summary of the advantages and disadvantages of the methods used for NF-κB detection.

Techniques: Enzyme-linked Immunosorbent Assay, Luciferase, Reporter Assay, Gene Expression, Real-time Polymerase Chain Reaction, Western Blot, Nucleic Acid Electrophoresis, Mobility Shift, Molecular Weight, Immunohistochemistry, Immunostaining, Amplification, Chromatin Immunoprecipitation, DNA Binding Assay, Immunoprecipitation

Review

nf κb dna binding activity (Thermo Fisher)

Structured Review

Images

Related Articles

Activity Assay:

Enzyme-linked Immunosorbent Assay:

Binding Assay:

Electrophoretic Mobility Shift Assay:

Incubation:

Labeling:

Sequencing:

Similar Products

Image Search Results